Am J Physiol Endocrinol Metab 290: E103–E113, 2006. First published September 6, 2005; doi:10.1152/ajpendo.00605.2004. Plasminogen activator inhibitor-1 modulates adipocyte differentiation Xiubin Liang,1 Talerngsak Kanjanabuch,1 Su-Li Mao,1 Chuan-Ming Hao,2 Yi-Wei Tang,1,2 Paul J. Declerck,3 Alyssa H. Hasty,4 David H. Wasserman,4 Agnes B. Fogo,1,2 and Li-Jun Ma1 Departments of 1Pathology, 2Medicine, and 4Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennessee; and 3Laboratory for Pharmaceutical Biology and Phytopharmacology, Katholieke Universiteit Leuven, Leuven, Belgium Submitted 29 December 2004; accepted in final form 29 July 2005 Liang, Xiubin, Talerngsak Kanjanabuch, Su-Li Mao, ChuanMing Hao, Yi-Wei Tang, Paul J. Declerck, Alyssa H. Hasty, David H. Wasserman, Agnes B. Fogo, and Li-Jun Ma. Plasminogen activator inhibitor-1 modulates adipocyte differentiation. Am J Physiol Endocrinol Metab 290: E103–E113, 2006. First published September 6, 2005; doi:10.1152/ajpendo.00605.2004.—Increased plasminogen activator inhibitor-1 (PAI-1) is linked to obesity and insulin resistance. However, the functional role of PAI-1 in adipocytes is unknown. This study was designed to investigate effects and underlying mechanisms of PAI-1 on glucose uptake in adipocytes and on adipocyte differentiation. Using primary cultured adipocytes from PAI-1⫹/⫹ and PAI-1⫺/⫺ mice, we found that PAI-1 deficiency promoted adipocyte differentiation, enhanced basal and insulin-stimulated glucose uptake, and protected against tumor necrosis factor-␣induced adipocyte dedifferentiation and insulin resistance. These beneficial effects were associated with upregulated glucose transporter 4 at basal and insulin-stimulated states and upregulated peroxisome proliferator-activated receptor-␥ (PPAR␥) and adiponectin along with downregulated resistin mRNA in differentiated PAI-1⫺/⫺ vs. PAI-1⫹/⫹ adipocytes. Similarly, inhibition of PAI-1 with a neutralizing anti-PAI-1 antibody in differentiated 3T3-L1 adipocytes further promoted adipocyte differentiation and glucose uptake, which was associated with increased expression of transcription factors PPAR␥, CCAAT enhancer-binding protein-␣ (C/EBP␣), and the adipocyte-selective fatty acid-binding protein aP2, thus mimicking the phenotype in PAI-1⫺/⫺ primary adipocytes. Conversely, overexpression of PAI-1 by adenovirus-mediated gene transfer in 3T3-L1 adipocytes inhibited differentiation and reduced PPAR␥, C/EBP␣, and aP2 expression. This was also associated with a decrease in urokinasetype plasminogen activator mRNA expression, decreased plasmin activity, and increased collagen I mRNA expression. Collectively, these results indicate that absence or inhibition of PAI-1 in adipocytes protects against insulin resistance by promoting glucose uptake and adipocyte differentiation via increased PPAR␥ expression. We postulate that these PAI-1 effects on adipocytes may, at least in part, be mediated via modulation of plasmin activity and extracellular matrix components. plasminogen activator inhibitor-1; peroxisome proliferator-activated receptor-␥; adipocyte differentiation; glucose uptake; insulin resistance PLASMINOGEN ACTIVATOR INHIBITOR-1 (PAI-1), a member of the serine proteinase inhibitor family, is the major physiological inhibitor of tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator (uPA). PAI-1 not only inhibits fibrinolysis but also has complex interactions with cellular matrices, and further inhibits proteolysis (21, 37). Increased Address for reprint requests and other correspondence: L.-J. Ma, MCN C4209, Dept. of Pathology, Vanderbilt Univ. Medical Center, 21st and Garland Ave., Nashville, TN 37232-2561 (e-mail: lijun.ma@vanderbilt.edu). X. Liang and T. Kanjanabuch contributed equally to this study. http://www.ajpendo.org PAI-1 has been associated with fibrosis and thrombosis in experimental models and humans (20, 28, 30, 39, 62). Emerging evidences implicate PAI-1 as a significant risk factor for macrovascular and microvascular complications of diabetes. PAI-1 is also linked to insulin resistance. Indeed, circulating PAI-1 levels are elevated at an early stage of impaired glucose tolerance and continue to be elevated as diabetes and the metabolic syndrome develop (29, 38). Plasma PAI-1 correlates strongly with the degree of insulinemia, and PAI-1 levels are further increased in type 2 diabetes even after correction for insulin levels (2, 42, 61). Increased circulating PAI-1 levels are also found in offspring and relatives of type 2 diabetics (22). Obesity also contributes significantly to elevated plasma PAI-1 levels. PAI-1 is overexpressed in adipose tissue of obese mice and humans (1, 53). In contrast, surgical fat removal or weight loss attributed to diet-mediated fat reduction is associated with a decrease in plasma PAI-1 in obese subjects (31, 45). In previous studies, increased PAI-1 levels were presumed to be consequent to obesity and insulin resistance. Our recent data indicate that PAI-1 may not merely increase in response to development of obesity and insulin resistance but may have a direct causal role (40). Using a high-fat diet-induced obesity and insulin resistance mouse model, we found that PAI-1 deficiency completely prevented development of obesity and insulin resistance (40). Although adipose tissue only accounts for a relatively small proportion (⬍10%) of the peripheral glucose utilization in response to insulin in nonobese humans and animals, adipocytes may still play an important role in insulin resistance (57). PAI-1, like tumor necrosis factor-␣ (TNF-␣), adiponectin, and resistin, is highly expressed in adipose tissues of obese animals and human subjects (3, 14, 27, 50). However, the functions of PAI-1 in differentiated adipocytes remain unknown. Adipocyte differentiation is a complex process. The differentiation of fibroblast-like preadipocytes to mature adipocytes involves striking morphological and biochemical changes. Besides the key regulatory roles of two well-characterized adipogenic transcription factors, CCAAT enhancer-binding protein-␣ (C/EBP␣) and peroxisome proliferator-activated receptor-␥ (PPAR␥; see Ref. 49), multiple events occur during adipocyte differentiation, including dynamic changes of cellmatrix interactions and extensive extracellular matrix (ECM) remodeling (11). On the basis of the established role of PAI-1 in inhibition of ECM degradation, we hypothesized that alteration of PAI-1 will affect remodeling of ECM, adipose differentiation, and insulin resistance in adipocytes. The present The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 0193-1849/06 $8.00 Copyright © 2006 the American Physiological Society Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. E103 E104 PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION study was therefore designed to investigate underlying mechanisms by which PAI-1 influences differentiation and glucose homeostasis in adipocytes. RESEARCH DESIGN AND METHODS Cell culture. Two in vitro cell culture models were used in this study. To determine the effects of PAI-1 deficiency on adipocyte differentiation, glucose uptake, and TNF-␣-induced insulin resistance, primary cultures of adipocytes were obtained from 4-wk-old male PAI-1⫹/⫹ or PAI-1⫺/⫺ mice (both on C57BL/6 background) as previously described (8, 24, 40). Differentiation of preadipocytes to adipocytes was induced by addition of an adipogenic hormonal cocktail (1 ␮g/ml insulin, 0.25 ␮M dexamethasone, and 0.5 mM isobutylmethylxanthine) and confirmed morphologically by multiple oil red O-stained fat droplets in the cytoplasm (40). Primary adipocytes at day 10 after induction of differentiation were used for this study. Insulin-resistant primary adipocytes were obtained by incubating these differentiated 10-day adipocytes for an additional 3 days in the presence of 3 ng/ml TNF-␣ (Sigma, St. Louis, MO) with or without insulin stimulation for 10 min (52). For studies of altered PAI-1 expression, we used murine 3T3-L1 preadipocytes (American Type Culture Collection, Manassas, VA) grown in DMEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 50 U/ml penicillin, and 50 ␮g/ml streptomycin at 37°C in 5% CO2. After confluence was reached (2 days), differentiation was initiated with adipogenic hormonal cocktail as described above for 2 days and then with DMEM containing insulin (1 ␮g/ml) alone for 2 days, followed by an additional 2 days in medium without insulin. These differentiated 3T3-L1 adipocytes at day 6 exhibited intracellular lipid droplets and were used for this study. To inhibit PAI-1, 3T3-L1 preadipocytes were treated for 6 days with a neutralizing monoclonal antibody against PAI-1 (MA-33H1F7, 10 ␮g/ml) along with induction of differentiation (6, 7, 15). MA-33H1F7 inhibits mouse and rat PAI-1 by converting PAI-1 to a noninhibitory substrate for tPA (16). The inhibiting efficacy of this antibody on PAI-1 has been demonstrated in vivo (6). The dose of anti-PAI-1 antibody was chosen on the basis of its biological activity in inhibiting PAI-1 effects on angiogenesis in vitro (46). A class-matched, noninhibitory monoclonal antibody (MA-32K3) was used as a control antibody. Adenoviral infection of 3T3-L1 preadipocytes. Recombinant adenovirus bearing human PAI-1 (Ad-PAI-1) and control adenovirus expressing Escherichia coli ␤-galactosidase (Ad-lacz) were gifts from Dr. Robert Gerard (University of Texas Southwestern Medical Center; see Refs. 10 and 33). The recombinant viruses were propagated in HEK 293 cells and purified by CsCl density gradient centrifugation. 3T3-L1 preadipocyte cultures (2 days postconfluence) in six-well plates were infected with the Ad-PAI-1 or Ad-lacz by addition of 1 ⫻ 109 plaque-forming units/well for 3 h before induction of differentiation. The medium containing free virus was then removed, fresh DMEM with 10% fetal bovine serum was added, and cells were induced to differentiate as above. Oil Red O staining. Differentiation of preadipocytes to adipocytes was monitored by measurement of intracellular lipid accumulation using Oil Red O staining. After fixation with 10% formalin in PBS for 1 h, the cells were washed and stained with filtered 0.3% Oil Red O in 55% isopropanol for 1 h (40), followed by counterstaining with 0.5% methyl green (Polysciences, Warrington, PA) in 0.1 M sodium acetate, pH 7.4. Differentiation was calculated as percent cells with Oil Red O positivity of total cells, assessed under ⫻100 magnification. Glucose uptake. [2-3H]deoxyglucose uptake was measured as described previously (40, 43). Briefly, primary adipocytes (10 days postdifferentiation) and 3T3-L1 adipocytes (6 days postdifferentiation) in six-well plates were cultured overnight in serum free-DMEM with low glucose (1 g/l). After KRP buffer wash (containing 136 mM NaCl, 4.7 mM KCl, 1 mM CaCl2, 1 mM MgSO4, 5 mM sodium AJP-Endocrinol Metab • VOL pyrophosphate, 20 mM HEPES, and 1% BSA), cells were incubated with 1 ml KRP buffer at 37°C for 20 min in the presence or absence of insulin as indicated. [2-3H]deoxyglucose was added for a final concentration of 0.1 mM (11.0 Ci/mmol; PerkinElmer Life Sciences, Boston, MA) and incubated for 10 min at 37°C. The cells were washed with cold KRP buffer and solubilized in 0.1% SDS. The radioactivity of a 200-␮l aliquot was determined in a scintillation counter. Glucose uptake was expressed as the degree of increase compared with basal PAI-1⫹/⫹ or 3T3-L1 cells, normalized to protein concentration in each sample. RNA extraction and assessment. Total RNA was extracted from cells as described previously (40, 41). Relative quantitation of expression of several murine genes in primary adipocytes and 3T3-L1 adipocytes was determined by a real-time, one-step RT-PCR assay (TaqMan) using an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA). A 25-␮l reaction mixture containing 2 ␮g of total RNA, 0.5 ␮M of each primer, and 0.2 ␮M TaqMan probe was mixed with 25 ␮l of the TaqMan One-Step RT-PCR 2⫻ Master Mix (Applied Biosystems), as described previously (17). Primers and probes designed to target mouse PPAR␥, adiponectin, resistin, PAI-1, uPA, and collagen I genes are listed in Table 1. The reaction conditions were designed as follows: RT at 48°C for 30 min and initial denaturation at 95°C for 10 min followed by 40 cycles with 15 s at 95°C for denaturing and 1 min at 60°C for annealing and extension. The threshold cycle (CT), i.e., the cycle number at which the amount of amplified gene of interest reached a fixed threshold, was subsequently determined. Relative quantification of each target mRNA level was normalized to 18S rRNA or ␤-actin and calculated by the comparative CT method described elsewhere (36). Immunofluorescence. 3T3-L1 cells cultured on cover slips were infected with Ad-PAI-1 or Ad-lacz or not treated as described above. After fixation in methanol-acetone (1:1) for 10 min at room temperature, the cells were permeabilized and blocked with 0.1% Triton X-100 and 5% BSA in PBS for 10 min. After being washed, the cells were then incubated with sheep anti-PAI-1 antibody (1:25; American Diagnostica, Stamford, CT) or goat anti-␤-Gal antibody (1:25; Bio- Table 1. Nucleotide sequences of oligonucleotide primers and probes (5⬘ to 3⬘) for real-time PCR Genes 5⬘ to 3⬘ Oligonucleotide Sequences Mouse PPAR␥ Sense Antisense Probe Mouse adiponectin Sense Antisense Probe Mouse resistin Sense Antisense Probe Mouse PAI-1 Sense Antisense Probe* Mouse uPA Sense Antisense Probe* Mouse collagen I Sense Antisense Probe* CTGTTATGGGTGAAACTCTGGGAG ATAGGCAGTGCATCAGCGAA TCCTGTTGACCCAGAGCATGGTGC TGTTGGAATGACAGGAGCTGAA CACACTGAAGCCTGAGCGATAC CATAAGCGGCTTCTCCAGGCTCTCCT TCGTGGGACATTCGTGAAGA GCGGGCTGCTGTCCAG AAAGTGTGTCACTGCCAGTGTGCAAGGAT AACCCGGCGGCAGATC CTTGAGATAGGACAGTGCTT TGGCCCATGGCACCCTCC TATTCTTCCGGGCA CTTCGACTGACCCAGGTAGACAA TCCCAAAGAAGGAAAAC GGGCGRGTGCTGTGCTTT CTCCTACATCTTCTGAGTTTGGTGATAC TATTCTTCCGGGCA *These probes were dually labeled with 6-carboxyfluorescein at the 5⬘ end and minor groove binder at the 3⬘ end. 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. E105 PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION genesis) for 1 h at room temperature. FITC-conjugated rabbit antisheep IgG (DakoCytomation, Carprinteria, CA) or FITC-conjugated rabbit anti-goat IgG antibodies (Dako) were then applied and incubated for 1 h. Internalization of inhibitory monoclonal PAI-1 antibody or control antibody in 3T3-L1 cells was assessed by direct staining of permeabilized cells with fluorochrome tetramethylrhodamine isothiocyanate-conjugated rabbit anti-mouse IgG (1:25; Dako). Images of immunofluorescent cells were captured with a Zeiss AxioCam camera attached to a Nikon Eclipse E400 microscope. Western blotting. Adipocytes (primary and 3T3-L1) grown in six-well plates were induced to differentiate along with treatments indicated above. Cells were lysed in lysis buffer [containing 150 mM NaCl, 50 mM Tris 䡠 HCl, pH 7.5, 5 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 100 ␮g/ml phenylmethylsulfonyl fluoride, and 1:100 proteinase inhibitor cocktail tablet (Roche Diagnostics, Mannheim, Germany)]. Total protein (30 ␮g) was separated on SDS-PAGE and transferred to a nitrocellulose membrane. Western blottings were performed with polyclonal rabbit antibodies against PPAR␥ (catalog no. 2492; Cell Signaling Technology, Beverly, MA), C/EBP␣ (14AA; Santa Cruz Biotechnology, Santa Cruz, CA), or fatty acid-binding protein (aP2, C-15; Santa Cruz Biotechnology). The blots were subsequently incubated with horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG (Amersham Biosciences, Little Chalfont, UK) or HRP-conjugated bovine antigoat IgG (Santa Cruz Biotechnology). Immunoreactive proteins were detected and visualized by using enhanced chemiluminescence detection reagents (Amersham Biosciences). The membranes were restripped for ␤-actin by using monoclonal anti-␤-actin antibody (Sigma), as a control for normalization. Plasmin activity. Total plasmin activity in 3T3-L1 cells lysis was measured by a modified protocol as described previously (28) using a plasmin-specific chromogenic substrate (Chromozym PL; Roche Molecular Biochemicals, Indianapolis, IN). This substance is specifically cleaved by plasmin into a residual peptide and 4-nitroaniline, which can be detected spectrophotometrically. 3T3-L1 adipocyte lysis (80 ␮l) and 20 ␮l of 3 mM Chromozym PL were added per reaction. Absorbance was measured at 405 nm. A standard linear curve was generated with serial dilutions of human plasmin (Roche). Results are expressed as units per milligram protein. Statistical analysis. Data are presented as means ⫾ SE, unless otherwise noted. P values were calculated by ANOVA followed by unpaired t-test as appropriate. A P value of ⬍0.05 was considered to be significant. RESULTS PAI-1 deficiency or inhibition stimulates adipocyte differentiation. To address whether the absence of PAI-1 affects adipocyte differentiation, primary cultured adipocytes from PAI-1⫹/⫹ and PAI-1⫺/⫺ mice were used. Preadipocytes from PAI-1⫺/⫺ showed more avid differentiation (75 ⫾ 1.2 vs. 60 ⫾ 2.4%, P ⬍ 0.01) and smaller mature adipocytes vs. PAI-1⫹/⫹ at day 10 after induction (Fig. 1, A–D). Consistent with these morphological observations, differentiated PAI-1⫺/⫺ adipocytes expressed higher levels of the adipocyte-related transcription factor C/EBP␣ (Fig. 2A) and adipogenic marker aP2 (Fig. 2B) compared with PAI-1⫹/⫹ at 10 days after induction (Fig. 2, A and B). Exposure of the differentiated primary PAI-1⫹/⫹ adipocytes to TNF-␣ (3 ng/ml) for 3 days resulted in decreased C/EBP␣ and aP2, consistent with dedifferentiation effects of TNF-␣ (47, 58). However, C/EBP␣ and aP2 protein levels in response to TNF-␣ in PAI-1⫺/⫺ adipocytes were relatively more preserved with less decrease vs. PAI-1⫹/⫹ adipocytes (Fig. 2, A and B). In the present study, we confirmed again that PAI-1 deficiency in primary adipocytes significantly enhanced basal glucose uptake vs. PAI-1⫹/⫹ (5.8-fold increase in PAI-1⫺/⫺ vs. PAI-1⫹/⫹, P ⬍ 0.01, Fig. 3A; see Ref. 40). PAI-1 deficiency further enhanced insulin-stimulated glucose uptake over a range of insulin doses in differentiated adipocytes compared with differentiated PAI-1⫹/⫹ adipocytes (Fig. 3A). As ex- Fig. 1. Effects of plasminogen activator inhibitor (PAI)-1 deficiency on adipocyte differentiation in primary cultured adipocytes. Cells were stained with Oil Red O at day 10 after induction of differentiation and examined microscopically (left, ⫻400) and macroscopically (right). Compared with PAI-1⫹/⫹ adipocytes (A and B), PAI-1⫺/⫺ primary cultured adipocytes were more differentiated and smaller (C and D). AJP-Endocrinol Metab • VOL 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. E106 PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION Fig. 2. PAI-1 deficiency protects against tumor necrosis factor (TNF)-␣induced adipocyte dedifferentiation. Representative Western blot analysis of CCAAT enhancer-binding protein-␣ (C/EBP␣) and fatty acid-binding protein (aP2) in day 10 differentiated PAI-1⫹/⫹ and PAI-1⫺/⫺ primary adipocytes in the presence or absence of TNF-␣ (3 ng/ml) for 3 additional days. pected, the response of PAI-1⫹/⫹ adipocytes to insulin (10 or 100 nM) stimulation in the presence of TNF-␣ was impaired, and glucose uptake was almost completely abolished. In contrast, basal and insulin (10 or 100 nM)-stimulated glucose uptake in PAI-1⫺/⫺ adipocytes was maintained at high levels (Fig. 3A), indicating the absence of TNF-␣-mediated insulin resistance in PAI-1⫺/⫺ cells. To understand the effect of PAI-1 deficiency on enhanced glucose uptake, we first measured total cellular GLUT4 levels in primary adipocytes by Western blot analysis. In the insulinfree basal state, total cellular GLUT4 protein levels were increased 1.6-fold in differentiated day 10 PAI-1⫺/⫺ vs. PAI1⫹/⫹ primary adipocytes (Fig. 3B). After insulin (100 nM) stimulation, GLUT4 protein levels were further increased in both PAI-1⫺/⫺ vs. PAI-1⫹/⫹ primary adipocytes vs. that seen in the basal state (2.8- and 2.1-fold, respectively; Fig. 3B). To further test whether inhibition of PAI-1 in 3T3-L1 cells could reproduce the PAI-1 deficiency-associated phenotype noted in primary adipocytes, 3T3-L1 cells were treated with a neutralizing anti-PAI-1 antibody (MA-33H1F7) for 6 days along with induction of differentiation. Oil Red O staining showed an average of 60 ⫾ 4% of control 3T3-L1 preadipocytes were differentiated into adipocytes at day 6 after induction (Fig. 4A). The addition of anti-PAI-1 antibody to 3T3-L1 cells coupled with standard adipogenic-inducing cocktail led to a further increase in adipocyte differentiation (87 ⫾ 7%; Fig. 4B) compared with control-induced 3T3-L1 cells (Fig. 4A) or differentiated 3T3-L1 cells treated with a class-matched noninhibitory control antibody (Fig. 4C). None of the control groups without induction showed differentiation, as evidenced by lack of Oil Red O staining (Fig. 4, F–H). AJP-Endocrinol Metab • VOL Glucose uptake was similar in day 6 differentiated 3T3-L1 adipocytes in all groups at baseline without insulin stimulation and was increased significantly in response to insulin (100 nM). This increased glucose uptake in response to insulin stimulation was further upregulated in anti-PAI-1 antibodytreated, differentiated 3T3-L1 adipocytes compared with those differentiated 3T3-L1 adipocytes without antibody treatment or treated with nonspecific control antibodies (Fig. 5). Effects of PAI-1 deficiency or inhibition on expression of genes related to insulin sensitivity and ECM modulation. We next examined the expression of key genes that regulate insulin sensitivity by real-time RT-PCR. The absence or presence of PAI-1 in primary preadipocytes before induction had no significant effect on mRNA expressions of PPAR␥ or adiponectin (Fig. 6, A and B). In contrast, when PAI-1⫹/⫹ adipocytes were differentiated at day 10 after induction, PPAR␥ and adiponectin were both markedly increased compared with undifferentiated preadipocytes. Interestingly, differentiated adipocytes deficient in PAI-1 showed even further upregulation of PPAR␥ and adiponectin (1.8- and 1.3-fold of PAI-1⫹/⫹ differentiated cells, respectively; Fig. 6, A and B). In contrast, resistin mRNA was significantly downregulated in PAI-1⫺/⫺ (⬃7-fold) vs. PAI-1⫹/⫹ adipocytes after differentiation (Fig. 6C). We next examined the effects of inhibition of PAI-1 on expression of the transcription factors PPAR␥ and C/EBP␣ and the adipocyte differentiation marker aP2 in differentiated 3T3-L1 adipocytes after PAI-1 antibody treatment. Endogenous PAI-1 mRNA expression in 3T3-L1 cells was not different before or after induction of differentiation. Unexpectedly, PAI-1 antibody treatment led to a decrease of PAI-1 mRNA Fig. 3. PAI-1 deficiency protects against TNF-␣-induced insulin resistance in adipocytes. A: representative glucose uptake in day 10 differentiated PAI-1⫹/⫹ (light gray bars) and PAI-1⫺/⫺ (black bars) primary adipocytes in response to insulin stimulation (0, 10, and 100 nM) in the presence or absence of TNF-␣ (3 ng/ml) for 3 days (n ⫽ 3–5 in each group, *P ⬍ 0.01). NS, not significant. B: effects of PAI-1 deficiency on total cellular GLUT4 protein in day 10 differentiated primary adipocytes in the presence or absence of insulin stimulation (100 nM) for 10 min. 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION E107 Fig. 4. Effect of modulation of PAI-1 on adipocyte differentiation of 3T3-L1 cells. Differentiated 3T3-L1 adipocytes at day 6 after induction (A) or undifferentiated 3T3-L1 preadipocytes (F) served as controls. 3T3-L1 preadipocytes were treated with PAI-1 antibody (B and G) or control antibody (C and H) for 6 days with (B and C) or without (G and H) induction of differentiation or were infected with adenovirus bearing human PAI-1 (Ad-PAI-1; D and I) or adenovirus expressing Escherichia coli ␤-galactosidase (Ad-lacz; E and J) with (D and E) or without (I and J) induction of differentiation for 6 days. Oil red O staining was performed to assess the status of differentiation (A-J, ⫻100). levels in differentiated 3T3-L1 cells (data not shown). PPAR␥ (Fig. 7, lane 1), C/EBP␣ (both 42- and 30-kDa isoforms), and aP2 (Fig. 8, A and B, lane 1) were undetectable or low in undifferentiated 3T3-L1 preadipocytes at baseline as assessed by Western blot analyses. PPAR␥ (Fig. 7, lane 2), C/EBP␣, and aP2 (Fig. 8, lane 2) were strongly induced in day 6 differentiated 3T3-L1 adipocytes compared with undifferentiated preadipocytes and were further upregulated when PAI-1 was inhibited via neutralizing anti-PAI-1 antibody (MA33H1F7; Figs. 7 and 8, lane 6). Noninhibitory control antibody (MA-32K3) had no effects on PAI-1 (data not shown), PPAR␥, C/EBP␣, and aP2 expressions (Figs. 7 and 8). Our data suggest that this increased PPAR␥ and C/EBP␣ might be potential contributors to the enhanced adipogenesis in PAI-1 antibodytreated 3T3-L1 adipocytes. As described above, differentiated 3T3-L1 cells treated with neutralized PAI-1 antibody had decreased PAI-1 mRNA levels (data not shown). We postulated that PAI-1 antibodies may Fig. 5. Effect of PAI-1 inhibition on insulin-stimulated glucose uptake in differentiated 3T3-L1 adipocytes. [2-3H]deoxyglucose uptake was assessed in day 6 differentiated 3T3-L1 adipocytes alone or in day 6 differentiated 3T3-L1 adipocytes treated for 6 days with neutralizing anti-PAI-1 antibody (MA33H1F7, 10 ␮g/ml) or control antibody (MA-32K3, 10 ␮g/ml) in the absence or presence of insulin (100 nM) stimulation (n ⫽ 3 experiments for each group). Ab, antibody; Cont, control. AJP-Endocrinol Metab • VOL Fig. 6. Effects of PAI-1 deficiency on gene expression in primary adipocytes. Peroxisome proliferator-activated receptor-␥ (PPAR␥; A), adiponectin (B), and resistin (C) mRNA expression in primary preadipocytes (day 0 after induction) and differentiated adipocytes (10 days after induction) was assessed by real-time quantitative RT-PCR and normalized to 18S ribosomal RNA (n ⫽ 3– 4 in each group). 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. E108 PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION Fig. 7. Representative Western blot analysis of PPAR␥ in 3T3-L1 adipocyte lysates. PPAR␥ protein expression was undetectable in undifferentiated cells alone (lane 1) or in undifferentiated cells infected with AdPAI-1 (lane 3) or treated with neutralizing anti-PAI-1 antibody (lane 5). PPAR␥ was induced in differentiated cells (lane 2). AdPAI-1 infection in differentiated cells inhibited PPAR␥ protein levels (lane 4). Conversely, PPAR␥ protein expression was further increased in differentiated cells after PAI-1 inhibition with neutralizing anti-PAI-1 antibody treatment (lane 6). Control Ad-lacz infection (lane 7) or control antibody treatment (lane 8) in differentiated cells had comparable PPAR␥ protein levels vs. normal differentiated cells (lane 2). have been internalized and thus interacted with PAI-1 protein, with postulated feedback effects on PAI-1 mRNA expression. Therefore, direct immunoflurescence staining was applied to localize the neutralizing monoclonal anti-PAI-1 antibody or control antibody in permeabilized 3T3-L1 cells with fluorochrome TRITC-conjugated rabbit anti-mouse IgG (1:25; Dako). 3T3-L1 cells treated with either PAI-1 antibody or control antibody displayed intracellular staining, whereas those cells without antibody treatment showed no staining (data not shown). Of note, these data do not clarify the molecular mechanism whereby intracellular PAI-1 antibody affected PAI-1 mRNA expression. The effects of the neutralizing anti-PAI-1 antibody on intracellular plasmin activity in 3T3-L1 cells were also assessed. In contrast to the decreased plasmin activity induced by PAI-1 overexpression, total plasmin activity was significantly increased (1.6-fold) in differentiated 3T3-L1 adipocytes cells after treatment with anti-PAI-1 antibody compared with control, differentiated 3T3-L1 adipocytes (66 ⫾ 2 vs. 42 ⫾ 1 U/␮g protein, P ⬍ 0.01). Overexpression of PAI-1 inhibits adipocyte differentiation. To investigate whether PAI-1 directly influences adipocyte differentiation, PAI-1 was overexpressed in 3T3-L1 adipocytes with the use of an adenovirus expression system. Low levels of PAI-1 were seen in noninfected, differentiated 3T3-L1 cells (Fig. 9A). Infectivity was assessed using an adenovirus expressing ␤-gal (Ad-lacz), confirming 70 –90% infectivity at 24 h posttransfection in day 1 differentiated 3T3-L1 adipocytes by indirect immunofluorescence (Fig. 9B). Comparable infection efficiencies of 70 –90% were also observed for adenovirus expressing PAI-1 (Ad-PAI-1; Fig. 9, C and E). Immunofluorescence staining results further confirmed that PAI-1 protein was markedly increased in Ad-PAI-1-infected 3T3-L1 cells at both 1 day and 6 days after differentiation (Fig. 9, C and E, respectively) vs. trace amounts in noninfected, differentiated 3T3-L1 cells (Fig. 9A). Control Ad-lacz had no effect on PAI-1 protein expressions in 3T3-L1 cells at either 1 day or 6 days after differentiation (Fig. 9, D and F, respectively). We next assessed the effect of overexpression of PAI-1 on adipocyte differentiation. In contrast to enhanced adipocyte AJP-Endocrinol Metab • VOL differentiation resulting from PAI-1 inhibition via anti-PAI-1 antibody treatment (Fig. 4B), PAI-1 overexpression inhibited adipocyte differentiation, leading to only 15 ⫾ 5% of Ad-PAI1-infected 3T3-L1 preadipocytes undergoing differentiation at day 6 after induction (P ⬍ 0.01; Fig. 4D). 3T3-L1 cells infected with control adenovirus carrying lacz (Fig. 4E) had comparable levels of differentiation as those cells treated with adipogenic cocktail only (Fig. 4A). Adenovirus-infected 3T3-L1 adipocytes without induction of adipogenesis showed no differentiation, as evidenced by lack of Oil Red O staining (Fig. 4, I and J). Effects of PAI-1 overexpression on adipogenic-related genes and ECM modulators. PAI-1 mRNA was overexpressed (4.8and 6.1-fold, respectively) in both undifferentiated and differentiated 3T3-L1 adipocytes (6 days after differentiation) after PAI-1 adenovirus infection compared with both undifferentiated preadipocytes and differentiated 3T3-L1 adipocytes (Fig. 10A). Control Ad-lacz had no effect on PAI-1 mRNA expression. The expressions of PPAR␥, C/EBP␣ (42- and 30-kDa isoforms), and aP2 were significantly downregulated in AdPAI-1-infected differentiated cells compared with noninfected differentiated cells (P ⬍ 0.01; Figs. 7 and 8). We next determined whether genes of ECM and related proteins were modulated after PAI-1 overexpression in differentiated 3T3-L1 cells. Quantitative real-time RT-PCR analysis revealed that uPA mRNA was highly expressed in differentiated 3T3-L1 adipocytes vs. 3T3-L1 preadipocytes (Fig. 10B). PAI-1-overexpressing undifferentiated 3T3-L1 cells showed no change in uPA mRNA expression. However, overexpression of PAI-1 in differentiated 3T3-L1 adipocytes inhibited the increase of uPA mRNA expression by 35% (P ⬍ 0.05 vs. noninfected cells; Fig. 10B). In contrast, collagen I mRNA expression was significantly decreased in differentiated 3T3-L1 cells vs. 3T3-L1 preadipocytes. Overexpression of PAI-1 in differentiated 3T3-L1 adipocytes resulted in increased collagen I mRNA expression compared with noninfected cells (2.6-fold increase, P ⬍ 0.05; Fig. 10C). Of note, infection with adenovirus carrying lacZ had no effect on the expression of genes examined (Fig. 10). 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. E109 PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION Fig. 8. Effects of modulation of PAI-1 on expression of C/EBP␣ and aP2 in 3T3-L1 adipocyte lysates by Western blot. C/EBP␣ (A) and aP2 (B) were expressed at low levels or undetectable in undifferentiated cells alone (lane 1) or in undifferentiated cells with indicated treatments (lanes 3, 5, 7, and 9). C/EBP␣ (A) and aP2 (B) were strongly induced in day 6 differentiated adipocytes (lane 2) and were downregulated in AdPAI-1 infected cells (lane 4), but were upregulated in differentiated cells after PAI-1 inhibition with neutralizing anti-PAI-1 antibody treatment (lane 6). Control Ad-lacz infection (lane 8) or control antibody treatment (lane 10) in differentiated cells had comparable C/EBP␣ (A) and aP2 (B) protein levels vs. normal differentiated cells (lane 2). AJP-Endocrinol Metab • VOL 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. E110 PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION Fig. 9. Overexpression of PAI-1 in 3T3-L1 cells detected by indirect immunofluorescence. A: low levels of PAI-1 were observed in noninfected, differentiated 3T3-L1 adipocytes. B: 70 –90% infectivity of adenovirus expressing ␤-gal (Ad-lacz) in 3T3-L1 adipocytes at 24 h after induction of differentiation was detected by indirect immunofluorescence staining. PAI-1 was markedly increased in 3T3-L1 adipocytes infected with Ad-PAI-1 at both 1 day (C) and 6 days (E) after differentiation vs. only trace amounts of PAI-1 expression in noninfected, differentiated 3T3-L1 cells (A). Control Ad-lacz had no effect on PAI-1 protein expressions in cells at either 1 day or 6 days after differentiation (D and F, respectively). To test our hypothesis that PAI-1 overexpression inhibits the plasminogen system during adipocyte differentiation, plasmin activity was measured. To this end, we compared differentiated 3T3-L1 cells with or without PAI-1 adenovirus infection. PAI-1 overexpression in differentiated 3T3-L1 adipocytes inhibited total plasmin activity ⬃26% vs. noninfected cells (31 ⫾ 2 vs. 42 ⫾ 6 U/␮g protein, P ⬍ 0.05). Plasmin levels were comparable between noninfected and Ad-lacZ-infected differentiated 3T3-L1 adipocytes (44 ⫾ 1, P ⫽ not significant). DISCUSSION Elevated plasma PAI-1 activity has been associated with insulin resistance and closely correlated with visceral fat accumulation in human subjects (1, 12, 23, 34). These data suggest that visceral adipose tissue can be an important contributor to the elevated plasma PAI-1 levels observed in obesity. Indeed, a large body of evidence indicates that adipose tissue produces substantial amounts of PAI-1. Despite the association between increased PAI-1 and obesity, the functional role of PAI-1 in differentiated adipocytes remains to be elucidated. To address this question, we used both PAI-1deficient primary adipocytes and the preadipocyte 3T3-L1 cell line. In this study, we provide evidence that PAI-1 deficiency promotes adipocyte differentiation and protects against TNF␣-induced dedifferentiation and insulin resistance in primary adipocytes. Inhibition of PAI-1 by an inhibitory anti-PAI-1 antibody in differentiated 3T3-L1 cells recaptured the phenoAJP-Endocrinol Metab • VOL type of PAI-1 deficiency and enhanced adipocyte differentiation of, and glucose uptake in, 3T3-L1 cells. Conversely, overexpression of PAI-1 in 3T3-L1 cells inhibited adipocyte differentiation. Our results clearly indicate that PAI-1 plays an important role in modulation of adipocyte differentiation. In our previous studies, we found decreased fat pad weight in PAI-1⫺/⫺ vs. PAI-1⫹/⫹ mice in response to a high-fat diet (40). Furthermore, adipocytes were smaller and more differentiated, with more Oil Red O staining in PAI-1⫺/⫺ mice vs. the wild type. Thus PAI-1 deficiency promoted adipocyte differentiation, but there was no overall increase in the mass of adipose tissue. There are several possible explanations for the discrepancy between positive correlation of PAI-1 with obesity observed in vivo vs. PAI-1-induced inhibition of adipocyte differentiation found in the present in vitro study. First, it could reflect differences in the role of systemic PAI-1 vs. possible local effects of PAI-1 in adipocytes. As evidenced in our previous study in PAI-1⫺/⫺ mice on a high-fat diet (40), systemic PAI-1 deficiency also increased resting metabolic rates and total energy expenditure, which was associated with a marked increase in uncoupling protein-3 expression in skeletal muscle, likely mechanisms contributing to prevention of obesity in vivo (40). Second, it is likely that PAI-1 is not the only factor influencing adipogenesis. Human obesity is controlled by many other factors. Adipocyte differentiation is regulated by the coordinated expression of various transcription factors, including PPAR␥ 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION Fig. 10. Effects of overexpression of PAI-1 in 3T3-L1 cells on gene expression involved in extracellular matrix turnover. 3T3-L1 preadipocytes were infected with adenovirus encoding ␤-gal (Ad-lacz) or adenovirus expressing PAI-1 (Ad-PAI-1). mRNA expressions of PAI-1 (A), urokinase-type plasminogen activator (uPA; B), and collagen I (C) were analyzed by quantitative real-time RT-PCR at 6 days after induction of differentiation and compared with cells without induction. Data are means ⫾ SE of values from 3 independent experiments. and the C/EBP family. PPAR␥ is believed to be the master regulator of adipocyte differentiation (35, 48, 49, 59, 65). Both PPAR␥ and the C/EBP family also play important roles in the regulation of insulin sensitivity (19, 32). Activation of PPAR␥ by synthetic and naturally occurring PPAR␥ activators regulates multiple genes involved in glucose and lipid metabolism, thereby ameliorating insulin resistance and type 2 diabetes (44). Conversely, dominant negative mutations in human PPAR␥ and adipose-specific PPAR␥ gene deletion in mice are associated with severe insulin resistance (4, 25). To investigate whether the modulating effects of PAI-1 on adipocyte differentiation and glucose uptake in adipocytes are contributed to by adipocyte-related key transcription factors PPAR␥ and C/EBP␣, we examined expression of PPAR␥, C/EBP␣, and PPAR␥ target genes, including aP2. In the present study, PAI-1 deficiency in primary adipocytes increased basal glucose upAJP-Endocrinol Metab • VOL E111 take and adipocyte differentiation, which was associated with increased PPAR␥ and C/EBP␣. Furthermore, PAI-1 inhibition (achieved by an inhibitory anti-PAI-1 antibody) resulted in enhanced adipocyte differentiation and was also associated with significantly upregulated PPAR␥, C/EBP␣, and aP2 expression in differentiated 3T3-L1 adipocytes. Conversely, PAI-1 overexpression in differentiated 3T3-L1 adipocytes inhibited adipocyte differentiation and was accompanied by decreases in PPAR␥, C/EBP␣, and aP2 levels. These observations imply that modulating effects of PAI-1 on glucose uptake and adipocyte differentiation were mediated, at least in part, by PPAR␥ and C/EBP␣. Glucose transport across the plasma membrane is mediated by a family of glucose transporter proteins (GLUTs). Upregulated GLUT4 in PAI-1-deficient primary adipocytes may also contribute to the increased basal glucose uptake. TNF-␣ is produced in and secreted by adipocytes, and has been implicated as an important mediator of insulin resistance and adipocyte differentiation (63). Blocking of TNF-␣ functions by either genetic deletion of the TNF-␣ receptor or neutralization of TNF-␣ in rodents protects from obesityinduced insulin resistance and increases insulin sensitivity (26, 27, 60). Interestingly, TNF-␣ induces PAI-1 expression in adipose tissue in rodents and humans (13, 51). In vitro, longterm exposure to TNF-␣ induces adipocyte dedifferentiation and suppresses insulin-stimulated glucose uptake in adipocytes (18). Negative regulation of PPAR␥ and C/EBP gene expression by TNF-␣ contributes to its inhibition of adipocyte differentiation, as well as its induction of insulin resistance (32, 47, 67). In this study, we have demonstrated that PAI-1 deficiency protects against TNF-␣-induced adipocyte dedifferentiation, as shown by relatively maintained expression of adipocyte transcription factor C/EBP␣ and the adipogenic marker aP2. We have further demonstrated that PAI-1 deficiency protects against TNF-␣-induced insulin resistance, as shown by the maintained high level of glucose uptake in adipocytes. Our results suggest increased PAI-1 levels promote insulin resistance in adipocytes, which may contribute to a role of PAI-1 in systemic insulin resistance (5, 40, 54). Our data also raise the interesting question that TNF-␣-induced insulin resistance might, at least in part, be mediated through PAI-1. Further study will be needed to address this hypothesis. Adipocyte differentiation is a complex process. It has been suggested recently that various factors in cell-cell and cellmatrix communications govern expression of adipocyte transcription factors and therefore regulate conversion of preadipocytes to adipocytes. During differentiation, expression of ECM components, including collagens and proteases, is changed (64, 66). Indeed, adipocytes produce and release a variety of proteolytic proteins (9, 11). Plasminogen activators tPA and uPA are serine proteinases that also play an important role in regulating adipose tissue remodeling. tPA expression and activity decreased, whereas uPA expression and activity increased during adipocyte differentiation (55). Conversely, inhibition of serine proteinase reduced adipocyte differentiation (56). Similarly, plasminogen deficiency suppressed differentiation of 3T3-L1 cells (56). The plasminogen cascade has been postulated to foster adipocyte differentiation by degradation of the fibronectin-rich preadipocyte stromal matrix (56). In the present study, our observations of decreased expression of collagen I and increased expression of uPA after 3T3-L1 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. E112 PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION adipocyte differentiation are consistent with previous data (55, 66). Interestingly, the inhibited adipocyte differentiation in PAI-1-overexpressing 3T3-L1 cells was associated with upregulated collagen I and downregulated uPA and plasmin. Conversely, PAI-1 inhibition via neutralizing PAI-1 antibody was associated with increased plasmin activity and increased adipocyte differentiation. Although there is no evidence that PAI-1 can directly affect PPAR␥, indirect interactions of PAI-1 with PPAR␥ through remodeling of ECM components are possible. We speculate that PAI-1 might modulate the microenvironment and network of ECM surrounding adipocytes via uPA and/or plasmin, affecting cell-ECM interactions and transduction of extracellular signals to intracellular components, such as PPAR␥. We further conclude that PAI-1 directly modulates adipocyte differentiation and glucose uptake. We postulate that PPAR␥ may contribute to PAI-1-modulated adipocyte differentiation and insulin sensitivity. Our data suggest that inhibition of PAI-1 might prove to be a novel anti-insulin resistance treatment. ACKNOWLEDGMENTS 11. 12. 13. 14. 15. 16. We thank HaiJing Li (Vanderbilt University School of Medicine) for technical support in real-time PCR. 17. GRANTS This work was supported by a Research Award from the American Diabetes Association (L.-J. Ma) and National Institutes of Health Grants DK-56942 (A. B. Fogo) and DK-50277 (D. H. Wasserman). 18. REFERENCES 1. Alessi MC, Peiretti F, Morange P, Henry M, Nalbone G, and JuhanVague I. Production of plasminogen activator inhibitor 1 by human adipose tissue: possible link between visceral fat accumulation and vascular disease. Diabetes 46: 860 – 867, 1997. 2. Asplund-Carlson A, Hamsten A, Wiman B, and Carlson LA. Relationship between plasma plasminogen activator inhibitor-1 activity and VLDL triglyceride concentration, insulin levels and insulin sensitivity: studies in randomly selected normal and hypertriglyceridaemic men. Diabetologia 36: 817– 825, 1993. 3. Banerjee RR, Rangwala SM, Shapiro JS, Rich AS, Rhoades B, Qi Y, Wang J, Rajala MW, Pocai A, Scherer PE, Steppan CM, Ahima RS, Obici S, Rossetti L, and Lazar MA. Regulation of fasted blood glucose by resistin. Science 303: 1195–1198, 2004. 4. Barroso I, Gurnell M, Crowley VE, Agostini M, Schwabe JW, Soos MA, Maslen GL, Williams TD, Lewis H, Schafer AJ, Chatterjee VK, and O’Rahilly S. Dominant negative mutations in human PPARgamma associated with severe insulin resistance, diabetes mellitus and hypertension. Nature 402: 880 – 883, 1999. 5. Bastard JP, Pieroni L, and Hainque B. Relationship between plasma plasminogen activator inhibitor 1 and insulin resistance. Diabetes Metab Res Rev 16: 192–201, 2000. 6. Berry CN, Lunven C, Lechaire I, Girardot C, and O’Connor SE. Antithrombotic activity of a monoclonal antibody inducing the substrate form of plasminogen activator inhibitor type 1 in rat models of venous and arterial thrombosis. Br J Pharmacol 125: 29 –34, 1998. 7. Bijnens AP, Gils A, Knockaert I, Stassen JM, and Declerck PJ. Importance of the hinge region between alpha-helix F and the main part of serpins, based upon identification of the epitope of plasminogen activator inhibitor type 1 neutralizing antibodies. J Biol Chem 275: 6375– 6380, 2000. 8. Bjorntorp P, Karlsson M, Pertoft H, Pettersson P, Sjostrom L, and Smith U. Isolation and characterization of cells from rat adipose tissue developing into adipocytes. J Lipid Res 19: 316 –324, 1978. 9. Bouloumie A, Sengenes C, Portolan G, Galitzky J, and Lafontan M. Adipocyte produces matrix metalloproteinases 2 and 9: involvement in adipose differentiation. Diabetes 50: 2080 –2086, 2001. 10. Carmeliet P, Moons L, Lijnen R, Janssens S, Lupu F, Collen D, and Gerard RD. Inhibitory role of plasminogen activator inhibitor-1 in arterial AJP-Endocrinol Metab • VOL 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. wound healing and neointima formation: a gene targeting and gene transfer study in mice. Circulation 96: 3180 –3191, 1997. Chavey C, Mari B, Monthouel MN, Bonnafous S, Anglard P, Van Obberghen E, and Tartare-Deckert S. Matrix metalloproteinases are differentially expressed in adipose tissue during obesity and modulate adipocyte differentiation. J Biol Chem 278: 11888 –11896, 2003. Cigolini M, Targher G, Seidell JC, Schiavon R, Manara F, Zenti MG, Mattioli C, and De Sandre G. Relationships of plasminogen activator inhibitor-1 to anthropometry, serum insulin, triglycerides and adipose tissue fatty acids in healthy men. Atherosclerosis 106: 139 –147, 1994. Cigolini M, Tonoli M, Borgato L, Frigotto L, Manzato F, Zeminian S, Cardinale C, Camin M, Chiaramonte E, De Sandre G, and Lunardi C. Expression of plasminogen activator inhibitor-1 in human adipose tissue: a role for TNF-alpha? Atherosclerosis 143: 81–90, 1999. Combs TP, Pajvani UB, Berg AH, Lin Y, Jelicks LA, Laplante M, Nawrocki AR, Rajala MW, Parlow AF, Cheeseboro L, Ding YY, Russell RG, Lindemann D, Hartley A, Baker GR, Obici S, Deshaies Y, Ludgate M, Rossetti L, and Scherer PE. A transgenic mouse with a deletion in the collagenous domain of adiponectin displays elevated circulating adiponectin and improved insulin sensitivity. Endocrinology 145: 367–383, 2004. Debrock S and Declerck PJ. Neutralization of plasminogen activator inhibitor-1 inhibitory properties: identification of two different mechanisms. Biochim Biophys Acta 1337: 257–266, 1997. Declerck PJ, De Mol M, Vaughan DE, and Collen D. Identification of a conformationally distinct form of plasminogen activator inhibitor-1, acting as a noninhibitory substrate for tissue-type plasminogen activator. J Biol Chem 267: 11693–11696, 1992. Deng X, Li H, and Tang YW. Cytokine expression in respiratory syncytial virus-infected mice as measured by quantitative reverse-transcriptase PCR. J Virol Methods 107: 141–146, 2003. Engelman JA, Berg AH, Lewis RY, Lisanti MP, and Scherer PE. Tumor necrosis fcator-a mediated insulin resistance, but not dedifferentiation, is abrogated by MEK1/2 inhibitors in 3T3-L1 adipocytes. Mol Endocrinol 14: 1557–1569, 2000. Evans RM, Barish GD, and Wang YX. PPARs and the complex journey to obesity. Nat Med 10: 355–361, 2004. Fogo AB. The potential for regression of renal scarring. Curr Opin Nephrol Hypertens 12: 223–225, 2003. Fogo AB. Renal fibrosis: not just PAI-1 in the sky. J Clin Invest 112: 326 –328, 2003. Gurlek A, Bayraktar M, and Kirazli S. Increased plasminogen activator inhibitor-1 activity in offspring of type 2 diabetic patients: lack of association with plasma insulin levels. Diabetes Care 23: 88 –92, 2000. Haffner SM, D’Agostino R Jr, Mykkanen L, Tracy R, Howard B, Rewers M, Selby J, Savage PJ, and Saad MF. Insulin sensitivity in subjects with type 2 diabetes relationship to cardiovascular risk factors: the Insulin Resistance Atherosclerosis Study. Diabetes Care 22: 562–568, 1999. Hauner H, Entenmann G, Wabitsch M, Gaillard D, Ailhaud G, Negrel R, and Pfeiffer EF. Promoting effect of glucocorticoids on the differentiation of human adipocyte precursor cells cultured in a chemically defined medium. J Clin Invest 84: 1663–1670, 1989. He W, Barak Y, Hevener A, Olson P, Liao D, Le J, Nelson M, Ong E, Olefsky JM, and Evans RM. Adipose-specific peroxisome proliferatoractivated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle. Proc Natl Acad Sci USA 100: 15712–15717, 2003. Hotamisligil GS, Budavari A, Murray D, and Spiegelman BM. Reduced tyrosine kinase activity of the insulin receptor in obesity-diabetes. Central role of tumor necrosis factor-alpha. J Clin Invest 94: 1543–1549, 1994. Hotamisligil GS, Shargill NS, and Spiegelman BM. Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259: 87–91, 1993. Huang Y, Haraguchi M, Lawrence DA, Border WA, Yu L, and Noble NA. A mutant, noninhibitory plasminogen activator inhibitor type 1 decreases matrix accumulation in experimental glomerulonephritis. J Clin Invest 112: 379 –388, 2003. Juhan-Vague I and Alessi MC. PAI-1, obesity, insulin resistance and risk of cardiovascular events. Thromb Haemost 78: 656 – 660, 1997. Juhan-Vague I, Alessi MC, and Vague P. Thrombogenic and fibrinolytic factors and cardiovascular risk in non-insulin-dependent diabetes mellitus. Ann Med 28: 371–380, 1996. 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022. PAI-1 MODULATES ADIPOCYTE DIFFERENTIATION 31. Kockx M, Leenen R, Seidell J, Princen HM, and Kooistra T. Relationship between visceral fat and PAI-1 in overweight men and women before and after weight loss. Thromb Haemost 82: 1490 –1496, 1999. 32. Kudo M, Sugawara A, Uruno A, Takeuchi K, and Ito S. Transcription suppression of peroxisome proliferator-activated receptor gamma2 gene expression by tumor necrosis factor alpha via an inhibition of CCAAT/ enhancer-binding protein delta during the early stage of adipocyte differentiation. Endocrinology 145: 4948 – 4956, 2004. 33. Lambert V, Munaut C, Noel A, Frankenne F, Bajou K, Gerard R, Carmeliet P, Defresne MP, Foidart JM, and Rakic JM. Influence of plasminogen activator inhibitor type 1 on choroidal neovascularization. FASEB J 15: 1021–1027, 2001. 34. Landin K, Stigendahl L, Eriksson E, Krotkiewski M, Risberg B, Tengborn L, and Smith U. Abdominal obesity is associated with an impaired fibrinolytic activity and elevated plasminogen activator inhibitor-1. Metabolism 39: 1044 –1048, 1990. 35. Lin FT and Lane MD. CCAAT/enhancer binding protein alpha is sufficient to initiate the 3T3-L1 adipocyte differentiation program. Proc Natl Acad Sci USA 91: 8757– 8761, 1994. 36. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2[-Delta Delta C(T)] method. Methods 25: 402– 408, 2001. 37. Loskutoff DJ. Regulation of PAI-1 gene expression. Fibrinolysis 5: 197–206, 1991. 38. Lyon CJ and Hsueh WA. Effect of plasminogen activator inhibitor-1 in diabetes mellitus and cardiovascular disease. Am J Med 115, Suppl 8A: 62S– 68S, 2003. 39. Ma LJ and Fogo AB. Angiotensin as inducer of plasminogen activator inhibitor-1 and fibrosis. Contrib Nephrol 135: 161–170, 2001. 40. Ma LJ, Mao SL, Taylor KL, Kanjanabuch T, Guan Y, Zhang Y, Brown NJ, Swift LL, McGuinness OP, Wasserman DH, Vaughan DE, and Fogo AB. Prevention of obesity and insulin resistance in mice lacking plasminogen activator inhibitor 1. Diabetes 53: 336 –346, 2004. 41. Ma LJ, Marcantoni C, Linton MF, Fazio S, and Fogo AB. Peroxisome proliferator-activated receptor-gamma agonist troglitazone protects against nondiabetic glomerulosclerosis in rats. Kidney Int 59: 1899 –1910, 2001. 42. Mavri A, Alessi MC, and Juhan-Vague I. Hypofibrinolysis in the insulin resistance syndrome: implication in cardiovascular diseases. J Intern Med 255: 448 – 456, 2004. 43. Mur C, Arribas M, Benito M, and Valverde AM. Essential role of insulin-like growth factor I receptor in insulin-induced fetal brown adipocyte differentiation. Endocrinology 144: 581–593, 2003. 44. Picard F and Auwerx J. PPAR(gamma) and glucose homeostasis. Annu Rev Nutr 22: 167–197, 2002. 45. Primrose JN, Davies JA, Prentice CR, Hughes R, and Johnston D. Reduction in factor VII, fibrinogen and plasminogen activator inhibitor-1 activity after surgical treatment of morbid obesity. Thromb Haemost 68: 396 –399, 1992. 46. Roca C, Primo L, Valdembri D, Cividalli A, Declerck P, Carmeliet P, Gabriele P, and Bussolino F. Hyperthermia inhibits angiogenesis by a plasminogen activator inhibitor 1-dependent mechanism. Cancer Res 63: 1500 –1507, 2003. 47. Ron D, Brasier AR, McGehee RE Jr, and Habener JF. Tumor necrosis factor-induced reversal of adipocytic phenotype of 3T3–L1 cells is preceded by a loss of nuclear CCAAT/enhancer binding protein (C/EBP). J Clin Invest 89: 223–233, 1992. 48. Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ, and Spiegelman BM. C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway. Genes Dev 16: 22–26, 2002. AJP-Endocrinol Metab • VOL E113 49. Rosen ED, Walkey CJ, Puigserver P, and Spiegelman BM. Transcriptional regulation of adipogenesis. Genes Dev 14: 1293–1307, 2000. 50. Saltiel AR. You are what you secrete. Nat Med 7: 887– 888, 2001. 51. Samad F and Loskutoff DJ. Tissue distribution and regulation of plasminogen activator inhibitor-1 in obese mice. Mol Med 2: 568 –582, 1996. 52. Sartipy P and Loskutoff DJ. Monocyte chemoattractant protein 1 in obesity and insulin resistance. Proc Natl Acad Sci USA 100: 7265–7270, 2003. 53. Sawdey MS and Loskutoff DJ. Regulation of murine type 1 plasminogen activator inhibitor gene expression in vivo. Tissue specificity and induction by lipopolysaccharide, tumor necrosis factor-alpha, and transforming growth factor-beta. J Clin Invest 88: 1346 –1353, 1991. 54. Schafer K, Fujisawa K, Konstantinides S, and Loskutoff DJ. Disruption of the plasminogen activator inhibitor 1 gene reduces the adiposity and improves the metabolic profile of genetically obese and diabetic ob/ob mice. FASEB J 15: 1840 –1842, 2001. 55. Seki T, Miyasu T, Noguchi T, Hamasaki A, Sasaki R, Ozawa Y, Okukita K, Declerck PJ, and Ariga T. Reciprocal regulation of tissuetype and urokinase-type plasminogen activators in the differentiation of murine preadipocyte line 3T3-L1 and the hormonal regulation of fibrinolytic factors in the mature adipocytes. J Cell Physiol 189: 72–78, 2001. 56. Selvarajan S, Lund LR, Takeuchi T, Craik CS, and Werb Z. A plasma kallikrein-dependent plasminogen cascade required for adipocyte differentiation. Nat Cell Biol 3: 267–275, 2001. 57. Smith U, Axelsen M, Carvalho E, Eliasson B, Jansson PA, and Wesslau C. Insulin signaling and action in fat cells: associations with insulin resistance and type 2 diabetes. Ann NY Acad Sci 892: 119 –126, 1999. 58. Stephens JM and Pekala PH. Transcriptional repression of the GLUT4 and C/EBP genes in 3T3-L1 adipocytes by tumor necrosis factor-alpha. J Biol Chem 266: 21839 –21845, 1991. 59. Tontonoz P, Hu E, and Spiegelman BM. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 79: 1147–1156, 1994. 60. Uysal KT, Wiesbrock SM, Marino MW, and Hotamisligil GS. Protection from obesity-induced insulin resistance in mice lacking TNF-alpha function. Nature 389: 610 – 614, 1997. 61. Vague P, Juhan-Vague I, Aillaud MF, Badier C, Viard R, Alessi MC, and Collen D. Correlation between blood fibrinolytic activity, plasminogen activator inhibitor level, plasma insulin level, ans relative body weight in normal and obese subjects. Metabolism 35: 250 –253, 1996. 62. Vaughan DE. Angiotensin and vascular fibrinolytic balance. Am J Hypertens 15: 3S– 8S, 2002. 63. Warne JP. Tumour necrosis factor alpha: a key regulator of adipose tissue mass. J Endocrinol 177: 351–355, 2003. 64. Weiner FR, Shah A, Smith PJ, Rubin CS, and Zern MA. Regulation of collagen gene expression in 3T3-L1 cells. Effects of adipocyte differentiation and tumor necrosis factor alpha. Biochemistry 28: 4094 – 4099, 1989. 65. Wu Z, Rosen ED, Brun R, Hauser S, Adelmant G, Troy AE, McKeon C, Darlington GJ, and Spiegelman BM. Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell 3: 151–158, 1999. 66. Yi T, Choi HM, Park RW, Sohn KY, and Kim IS. Transcriptional repression of type I procollagen genes during adipocyte differentiation. Exp Mol Med 33: 269 –275, 2001. 67. Zhang B, Berger J, Hu E, Szalkowski D, White-Carrington S, Spiegelman BM, and Moller DE. Negative regulation of peroxisome proliferator-activated receptor-gamma gene expression contributes to the antiadipogenic effects of tumor necrosis factor-alpha. Mol Endocrinol 10: 1457–1466, 1996. 290 • JANUARY 2006 • www.ajpendo.org Downloaded from journals.physiology.org/journal/ajpendo (034.227.047.098) on January 28, 2022.